human dmp 1 Search Results


92
R&D Systems human dmp1
FIGURE 1. Differential attachment of human dental pulp cells (DPC), sali- varyglandcells(HSG),andosteoblasticcells(MG63)tobonesialoprotein (BSP)-, dentin matrix protein-1 <t>(DMP1)-,</t> or osteopontin (OPN)-coated wells. Single-cell suspensions of DPC, HSG, and MG63 cells were incubated for 1 h on non-tissue culture wells precoated with BSP, DMP1, or OPN. Note that neither DMP1 nor OPN can support attachment of HSG cells, whereas all three cell types attach well to BSP. No significant number of cells attached to BSA-coated wells (not shown). The adherent cells were fixed, stained with crystal violet, and solubilized with SDS before reading at 560 nm. Bars show the mean S.E. from at least three independent experiments, each per- formed in triplicate.
Human Dmp1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human dmp1/product/R&D Systems
Average 92 stars, based on 1 article reviews
human dmp1 - by Bioz Stars, 2026-02
92/100 stars
  Buy from Supplier

93
Sino Biological human dmp1
FIGURE 1. Differential attachment of human dental pulp cells (DPC), sali- varyglandcells(HSG),andosteoblasticcells(MG63)tobonesialoprotein (BSP)-, dentin matrix protein-1 <t>(DMP1)-,</t> or osteopontin (OPN)-coated wells. Single-cell suspensions of DPC, HSG, and MG63 cells were incubated for 1 h on non-tissue culture wells precoated with BSP, DMP1, or OPN. Note that neither DMP1 nor OPN can support attachment of HSG cells, whereas all three cell types attach well to BSP. No significant number of cells attached to BSA-coated wells (not shown). The adherent cells were fixed, stained with crystal violet, and solubilized with SDS before reading at 560 nm. Bars show the mean S.E. from at least three independent experiments, each per- formed in triplicate.
Human Dmp1, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human dmp1/product/Sino Biological
Average 93 stars, based on 1 article reviews
human dmp1 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

85
Cusabio human dmp 1
FIGURE 1. Differential attachment of human dental pulp cells (DPC), sali- varyglandcells(HSG),andosteoblasticcells(MG63)tobonesialoprotein (BSP)-, dentin matrix protein-1 <t>(DMP1)-,</t> or osteopontin (OPN)-coated wells. Single-cell suspensions of DPC, HSG, and MG63 cells were incubated for 1 h on non-tissue culture wells precoated with BSP, DMP1, or OPN. Note that neither DMP1 nor OPN can support attachment of HSG cells, whereas all three cell types attach well to BSP. No significant number of cells attached to BSA-coated wells (not shown). The adherent cells were fixed, stained with crystal violet, and solubilized with SDS before reading at 560 nm. Bars show the mean S.E. from at least three independent experiments, each per- formed in triplicate.
Human Dmp 1, supplied by Cusabio, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human dmp 1/product/Cusabio
Average 85 stars, based on 1 article reviews
human dmp 1 - by Bioz Stars, 2026-02
85/100 stars
  Buy from Supplier

90
OriGene dmp1 primers
( A ) A schematic diagram showing that PR-flox is crossed to Mx1-Cre. Mx1-Cre can be activated by IFNα to delete exon 2 of the PR gene to generate PR mutants (ΔPR). ( B ) Mx1-Cre;PR-flox/flox calvarial cells were treated with IFNα (500 units/mL) or without IFNα (control) for three days. The cells were then differentiated into osteoblasts in osteogenic medium without IFNα for 14 days. The relative expressions of RUNX2, Osteocalcin (Ocn) and <t>DMP1</t> were evaluated by real-time PCR at day 14 and normalized to endogenous β-actin. ( C ) The cells were collected for alkaline phosphatase (ALP) activity assays on day 10 and alizarin red staining (AR) on day 21. The optical density (OD) values were normalized to the corresponding total protein concentrations. Calvarial cells from the PR-flox/flox (without Cre) mice were used as a negative control to exclude the effect of INFα itself. ( D ) The calvariae obtained from Mx1-Cre;mT/mG double transgenic pups exhibited significant numbers (~40%) of cells that became GFP-positive after three days of IFNα (500 units/mL) treatment, and significantly more cells (~80%) became GFP-positive after an additional six days of culture without IFNα. ( E ) Genomic DNA was isolated from PR-flox/flox calvarial cells three days after IFNα treatment, and subjected to PR allele-specific PCR. The deleted PR band (ΔPR) indicated Cre-mediated DNA recombination. ( F ) Five-weeks-old PR-flox/flox or Mx1-Cre;PR-flox/flox mice were injected with pI-pC. Calvariae were collected five months later for microCT analysis for bone volume and (G) representative calvarial images from microCT scans.
Dmp1 Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dmp1 primers/product/OriGene
Average 90 stars, based on 1 article reviews
dmp1 primers - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
R&D Systems mouse anti human dentin 1
( A ) A schematic diagram showing that PR-flox is crossed to Mx1-Cre. Mx1-Cre can be activated by IFNα to delete exon 2 of the PR gene to generate PR mutants (ΔPR). ( B ) Mx1-Cre;PR-flox/flox calvarial cells were treated with IFNα (500 units/mL) or without IFNα (control) for three days. The cells were then differentiated into osteoblasts in osteogenic medium without IFNα for 14 days. The relative expressions of RUNX2, Osteocalcin (Ocn) and <t>DMP1</t> were evaluated by real-time PCR at day 14 and normalized to endogenous β-actin. ( C ) The cells were collected for alkaline phosphatase (ALP) activity assays on day 10 and alizarin red staining (AR) on day 21. The optical density (OD) values were normalized to the corresponding total protein concentrations. Calvarial cells from the PR-flox/flox (without Cre) mice were used as a negative control to exclude the effect of INFα itself. ( D ) The calvariae obtained from Mx1-Cre;mT/mG double transgenic pups exhibited significant numbers (~40%) of cells that became GFP-positive after three days of IFNα (500 units/mL) treatment, and significantly more cells (~80%) became GFP-positive after an additional six days of culture without IFNα. ( E ) Genomic DNA was isolated from PR-flox/flox calvarial cells three days after IFNα treatment, and subjected to PR allele-specific PCR. The deleted PR band (ΔPR) indicated Cre-mediated DNA recombination. ( F ) Five-weeks-old PR-flox/flox or Mx1-Cre;PR-flox/flox mice were injected with pI-pC. Calvariae were collected five months later for microCT analysis for bone volume and (G) representative calvarial images from microCT scans.
Mouse Anti Human Dentin 1, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti human dentin 1/product/R&D Systems
Average 90 stars, based on 1 article reviews
mouse anti human dentin 1 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

93
OriGene human dmp1 gene
( A ) A schematic diagram showing that PR-flox is crossed to Mx1-Cre. Mx1-Cre can be activated by IFNα to delete exon 2 of the PR gene to generate PR mutants (ΔPR). ( B ) Mx1-Cre;PR-flox/flox calvarial cells were treated with IFNα (500 units/mL) or without IFNα (control) for three days. The cells were then differentiated into osteoblasts in osteogenic medium without IFNα for 14 days. The relative expressions of RUNX2, Osteocalcin (Ocn) and <t>DMP1</t> were evaluated by real-time PCR at day 14 and normalized to endogenous β-actin. ( C ) The cells were collected for alkaline phosphatase (ALP) activity assays on day 10 and alizarin red staining (AR) on day 21. The optical density (OD) values were normalized to the corresponding total protein concentrations. Calvarial cells from the PR-flox/flox (without Cre) mice were used as a negative control to exclude the effect of INFα itself. ( D ) The calvariae obtained from Mx1-Cre;mT/mG double transgenic pups exhibited significant numbers (~40%) of cells that became GFP-positive after three days of IFNα (500 units/mL) treatment, and significantly more cells (~80%) became GFP-positive after an additional six days of culture without IFNα. ( E ) Genomic DNA was isolated from PR-flox/flox calvarial cells three days after IFNα treatment, and subjected to PR allele-specific PCR. The deleted PR band (ΔPR) indicated Cre-mediated DNA recombination. ( F ) Five-weeks-old PR-flox/flox or Mx1-Cre;PR-flox/flox mice were injected with pI-pC. Calvariae were collected five months later for microCT analysis for bone volume and (G) representative calvarial images from microCT scans.
Human Dmp1 Gene, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human dmp1 gene/product/OriGene
Average 93 stars, based on 1 article reviews
human dmp1 gene - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

90
Bioworld Antibodies mouse anti-human dentin matrix protein-1 (dmp-1; cat. no. bs7995)
( A ) A schematic diagram showing that PR-flox is crossed to Mx1-Cre. Mx1-Cre can be activated by IFNα to delete exon 2 of the PR gene to generate PR mutants (ΔPR). ( B ) Mx1-Cre;PR-flox/flox calvarial cells were treated with IFNα (500 units/mL) or without IFNα (control) for three days. The cells were then differentiated into osteoblasts in osteogenic medium without IFNα for 14 days. The relative expressions of RUNX2, Osteocalcin (Ocn) and <t>DMP1</t> were evaluated by real-time PCR at day 14 and normalized to endogenous β-actin. ( C ) The cells were collected for alkaline phosphatase (ALP) activity assays on day 10 and alizarin red staining (AR) on day 21. The optical density (OD) values were normalized to the corresponding total protein concentrations. Calvarial cells from the PR-flox/flox (without Cre) mice were used as a negative control to exclude the effect of INFα itself. ( D ) The calvariae obtained from Mx1-Cre;mT/mG double transgenic pups exhibited significant numbers (~40%) of cells that became GFP-positive after three days of IFNα (500 units/mL) treatment, and significantly more cells (~80%) became GFP-positive after an additional six days of culture without IFNα. ( E ) Genomic DNA was isolated from PR-flox/flox calvarial cells three days after IFNα treatment, and subjected to PR allele-specific PCR. The deleted PR band (ΔPR) indicated Cre-mediated DNA recombination. ( F ) Five-weeks-old PR-flox/flox or Mx1-Cre;PR-flox/flox mice were injected with pI-pC. Calvariae were collected five months later for microCT analysis for bone volume and (G) representative calvarial images from microCT scans.
Mouse Anti Human Dentin Matrix Protein 1 (Dmp 1; Cat. No. Bs7995), supplied by Bioworld Antibodies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse anti-human dentin matrix protein-1 (dmp-1; cat. no. bs7995)/product/Bioworld Antibodies
Average 90 stars, based on 1 article reviews
mouse anti-human dentin matrix protein-1 (dmp-1; cat. no. bs7995) - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Becton Dickinson fulllength human dmp1
( A ) A schematic diagram showing that PR-flox is crossed to Mx1-Cre. Mx1-Cre can be activated by IFNα to delete exon 2 of the PR gene to generate PR mutants (ΔPR). ( B ) Mx1-Cre;PR-flox/flox calvarial cells were treated with IFNα (500 units/mL) or without IFNα (control) for three days. The cells were then differentiated into osteoblasts in osteogenic medium without IFNα for 14 days. The relative expressions of RUNX2, Osteocalcin (Ocn) and <t>DMP1</t> were evaluated by real-time PCR at day 14 and normalized to endogenous β-actin. ( C ) The cells were collected for alkaline phosphatase (ALP) activity assays on day 10 and alizarin red staining (AR) on day 21. The optical density (OD) values were normalized to the corresponding total protein concentrations. Calvarial cells from the PR-flox/flox (without Cre) mice were used as a negative control to exclude the effect of INFα itself. ( D ) The calvariae obtained from Mx1-Cre;mT/mG double transgenic pups exhibited significant numbers (~40%) of cells that became GFP-positive after three days of IFNα (500 units/mL) treatment, and significantly more cells (~80%) became GFP-positive after an additional six days of culture without IFNα. ( E ) Genomic DNA was isolated from PR-flox/flox calvarial cells three days after IFNα treatment, and subjected to PR allele-specific PCR. The deleted PR band (ΔPR) indicated Cre-mediated DNA recombination. ( F ) Five-weeks-old PR-flox/flox or Mx1-Cre;PR-flox/flox mice were injected with pI-pC. Calvariae were collected five months later for microCT analysis for bone volume and (G) representative calvarial images from microCT scans.
Fulllength Human Dmp1, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/fulllength human dmp1/product/Becton Dickinson
Average 90 stars, based on 1 article reviews
fulllength human dmp1 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

90
Bio-Techne corporation human dmp-1 duoset elisa
( A ) A schematic diagram showing that PR-flox is crossed to Mx1-Cre. Mx1-Cre can be activated by IFNα to delete exon 2 of the PR gene to generate PR mutants (ΔPR). ( B ) Mx1-Cre;PR-flox/flox calvarial cells were treated with IFNα (500 units/mL) or without IFNα (control) for three days. The cells were then differentiated into osteoblasts in osteogenic medium without IFNα for 14 days. The relative expressions of RUNX2, Osteocalcin (Ocn) and <t>DMP1</t> were evaluated by real-time PCR at day 14 and normalized to endogenous β-actin. ( C ) The cells were collected for alkaline phosphatase (ALP) activity assays on day 10 and alizarin red staining (AR) on day 21. The optical density (OD) values were normalized to the corresponding total protein concentrations. Calvarial cells from the PR-flox/flox (without Cre) mice were used as a negative control to exclude the effect of INFα itself. ( D ) The calvariae obtained from Mx1-Cre;mT/mG double transgenic pups exhibited significant numbers (~40%) of cells that became GFP-positive after three days of IFNα (500 units/mL) treatment, and significantly more cells (~80%) became GFP-positive after an additional six days of culture without IFNα. ( E ) Genomic DNA was isolated from PR-flox/flox calvarial cells three days after IFNα treatment, and subjected to PR allele-specific PCR. The deleted PR band (ΔPR) indicated Cre-mediated DNA recombination. ( F ) Five-weeks-old PR-flox/flox or Mx1-Cre;PR-flox/flox mice were injected with pI-pC. Calvariae were collected five months later for microCT analysis for bone volume and (G) representative calvarial images from microCT scans.
Human Dmp 1 Duoset Elisa, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human dmp-1 duoset elisa/product/Bio-Techne corporation
Average 90 stars, based on 1 article reviews
human dmp-1 duoset elisa - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

Image Search Results


FIGURE 1. Differential attachment of human dental pulp cells (DPC), sali- varyglandcells(HSG),andosteoblasticcells(MG63)tobonesialoprotein (BSP)-, dentin matrix protein-1 (DMP1)-, or osteopontin (OPN)-coated wells. Single-cell suspensions of DPC, HSG, and MG63 cells were incubated for 1 h on non-tissue culture wells precoated with BSP, DMP1, or OPN. Note that neither DMP1 nor OPN can support attachment of HSG cells, whereas all three cell types attach well to BSP. No significant number of cells attached to BSA-coated wells (not shown). The adherent cells were fixed, stained with crystal violet, and solubilized with SDS before reading at 560 nm. Bars show the mean S.E. from at least three independent experiments, each per- formed in triplicate.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE 1. Differential attachment of human dental pulp cells (DPC), sali- varyglandcells(HSG),andosteoblasticcells(MG63)tobonesialoprotein (BSP)-, dentin matrix protein-1 (DMP1)-, or osteopontin (OPN)-coated wells. Single-cell suspensions of DPC, HSG, and MG63 cells were incubated for 1 h on non-tissue culture wells precoated with BSP, DMP1, or OPN. Note that neither DMP1 nor OPN can support attachment of HSG cells, whereas all three cell types attach well to BSP. No significant number of cells attached to BSA-coated wells (not shown). The adherent cells were fixed, stained with crystal violet, and solubilized with SDS before reading at 560 nm. Bars show the mean S.E. from at least three independent experiments, each per- formed in triplicate.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Incubation, Staining

FIGURE 2. Cell attachment to BSP, DMP1, and OPN is RGD-dependent. DPCs were plated on wells coated with BSP (A), DMP1 (B), and OPN (C) or their respective KAE mutants. Noted cells were preincubated with 1 mM GRGDS competing peptide or the scrambled control peptide GRDGS for 15 min at room temperature prior to adding to wells. The attachment assays were performed and evaluated as described above. Bars show the mean S.E. from six independent experiments, each performed in triplicate.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE 2. Cell attachment to BSP, DMP1, and OPN is RGD-dependent. DPCs were plated on wells coated with BSP (A), DMP1 (B), and OPN (C) or their respective KAE mutants. Noted cells were preincubated with 1 mM GRGDS competing peptide or the scrambled control peptide GRDGS for 15 min at room temperature prior to adding to wells. The attachment assays were performed and evaluated as described above. Bars show the mean S.E. from six independent experiments, each performed in triplicate.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Cell Attachment Assay, Control

FIGURE 3. Cell attachment to DMP1 and OPN requires V3, whereas attachment to BSP can be pro- moted by either V3 or V5 integrins. Cells, as indicated, were plated on BSP-, DMP1-, or OPN-coated wells. Some cells were pretreated with 10 g/ml anti-1 (P4C10), anti-V3 (LM609), and/or anti-V5 (P1F6) function-blocking antibodies prior to and during the incubation. The attachment assays were performed and evaluated as described above. Cell attachment in the presence of IgG control was assigned a value of 100%. Bars show the mean S.E. from six independent experiments, each performed in triplicate. **, p 0.001, as compared with the corresponding IgG control value.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE 3. Cell attachment to DMP1 and OPN requires V3, whereas attachment to BSP can be pro- moted by either V3 or V5 integrins. Cells, as indicated, were plated on BSP-, DMP1-, or OPN-coated wells. Some cells were pretreated with 10 g/ml anti-1 (P4C10), anti-V3 (LM609), and/or anti-V5 (P1F6) function-blocking antibodies prior to and during the incubation. The attachment assays were performed and evaluated as described above. Cell attachment in the presence of IgG control was assigned a value of 100%. Bars show the mean S.E. from six independent experiments, each performed in triplicate. **, p 0.001, as compared with the corresponding IgG control value.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Cell Attachment Assay, Blocking Assay, Incubation, Control

FIGURE4.DenovoexpressionofV3integrincausesHSGcellstoattachtoDMP1-coatedsurfaces.A,cell surface expression of 1 subunit, V3, or V5 integrins on HSG cells before (black profiles) and after trans- duction with viral construct expressing V cDNA in combination with viruses expressing either 1 (left), or 3 (middle), or 5 (right) cDNA (gray profiles) as assessed by flow cytometry using monoclonal antibodies (4B7 for 1, LM609 for V3, and P1F6 for V5) and detected with Alexa Flour 488-labeled goat anti-mouse IgG. The expression level of each integrin on the cell surfaces is indicated by log fluorescence intensity (x-axis). Note that, among parental and adenoviral-infected HSG cells, only those expressing V3 significantly attached to either DMP1 (B)- or OPN (C)-coated wells. Cells infected with an adenovirus encoding no recombinant protein exhibited a profile (not shown) identical to parental cells (wt). The attachment assays were performed and evaluated as described above. Bars show the mean S.E. from seven independent experiments, each per- formed in triplicate. **, p 0.001, as compared with the control (wt) cells by means of t test.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE4.DenovoexpressionofV3integrincausesHSGcellstoattachtoDMP1-coatedsurfaces.A,cell surface expression of 1 subunit, V3, or V5 integrins on HSG cells before (black profiles) and after trans- duction with viral construct expressing V cDNA in combination with viruses expressing either 1 (left), or 3 (middle), or 5 (right) cDNA (gray profiles) as assessed by flow cytometry using monoclonal antibodies (4B7 for 1, LM609 for V3, and P1F6 for V5) and detected with Alexa Flour 488-labeled goat anti-mouse IgG. The expression level of each integrin on the cell surfaces is indicated by log fluorescence intensity (x-axis). Note that, among parental and adenoviral-infected HSG cells, only those expressing V3 significantly attached to either DMP1 (B)- or OPN (C)-coated wells. Cells infected with an adenovirus encoding no recombinant protein exhibited a profile (not shown) identical to parental cells (wt). The attachment assays were performed and evaluated as described above. Bars show the mean S.E. from seven independent experiments, each per- formed in triplicate. **, p 0.001, as compared with the control (wt) cells by means of t test.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Expressing, Construct, Flow Cytometry, Bioprocessing, Labeling, Fluorescence, Infection, Recombinant, Control

FIGURE 5. Integrin-activation by treatment with Mn2 enhances cell attachment on all three SIBLINGs. Cells, as indicated, were plated on wells precoated with BSP, DMP1, or OPN with or without 1 mM MnCl2 (DPC and HSG cells) or 0.25 mM MnCl2 (MG63 cells). The attachment assays were performed and evaluated as described above. The bars show the mean S.E. of three experiments, each performed in triplicate.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE 5. Integrin-activation by treatment with Mn2 enhances cell attachment on all three SIBLINGs. Cells, as indicated, were plated on wells precoated with BSP, DMP1, or OPN with or without 1 mM MnCl2 (DPC and HSG cells) or 0.25 mM MnCl2 (MG63 cells). The attachment assays were performed and evaluated as described above. The bars show the mean S.E. of three experiments, each performed in triplicate.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Activation Assay, Cell Attachment Assay

FIGURE6.Mn2-mediatedinductionofcellattachmenttoDMP1andOPN is V3-dependent. Single-cell suspension of MG63 cells was incubated with control IgG or the function blocking anti-V3 antibody (LM609) in the presence of 0.25 mM MnCl2 before plating on wells coated with either DMP1 (A) or OPN (B). The attachment assays were performed and evaluated as described above. Attachment of cells in the presence of IgG control was assigned a value of 100%. The bars show the mean S.E. of four experiments each performed in triplicate. **, p 0.001, as compared with the correspond- ing IgG control value by means of t test.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE6.Mn2-mediatedinductionofcellattachmenttoDMP1andOPN is V3-dependent. Single-cell suspension of MG63 cells was incubated with control IgG or the function blocking anti-V3 antibody (LM609) in the presence of 0.25 mM MnCl2 before plating on wells coated with either DMP1 (A) or OPN (B). The attachment assays were performed and evaluated as described above. Attachment of cells in the presence of IgG control was assigned a value of 100%. The bars show the mean S.E. of four experiments each performed in triplicate. **, p 0.001, as compared with the correspond- ing IgG control value by means of t test.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Suspension, Incubation, Control, Blocking Assay

FIGURE 7. Investigating DMP1 sequences involved in integrin specificity. HSG (naturally expressing V5 integrin), HSG-V3 (expressing V5 plus adenovirus-transduced V3 integrins), and MG63 (expressing both V3 and V5 integrins) cells as noted were plated on wells coated with native forms of BSP or DMP1, or one the following DMP1 constructs: BSP/DMP1- Hybrid (DMP1 with the first four coding exons of BSP fused to the last exon of DMP1); DMP1-BSP-likeRGD (DMP1 with its conserved SRGDNP sequence replaced by BSP’s conserved PRGDNY); DMP1 exon 6 (bacterial), truncated DMP1 protein without post-translational modification. Note that neither the first four exons nor the RGD domain of BSP replacing DMP1’s corresponding regions resulted in V5-attachment activity for HSG (A). Attachment of MG63 cells to BSP/DMP1 hybrid remained DMP1-like (B). Post-translational modifications are not required for DMP1’s specificity for V3 (C). The attach- ment assays were carried out and evaluated as described above. The bars show the mean S.E. of three experiments each performed in triplicate.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE 7. Investigating DMP1 sequences involved in integrin specificity. HSG (naturally expressing V5 integrin), HSG-V3 (expressing V5 plus adenovirus-transduced V3 integrins), and MG63 (expressing both V3 and V5 integrins) cells as noted were plated on wells coated with native forms of BSP or DMP1, or one the following DMP1 constructs: BSP/DMP1- Hybrid (DMP1 with the first four coding exons of BSP fused to the last exon of DMP1); DMP1-BSP-likeRGD (DMP1 with its conserved SRGDNP sequence replaced by BSP’s conserved PRGDNY); DMP1 exon 6 (bacterial), truncated DMP1 protein without post-translational modification. Note that neither the first four exons nor the RGD domain of BSP replacing DMP1’s corresponding regions resulted in V5-attachment activity for HSG (A). Attachment of MG63 cells to BSP/DMP1 hybrid remained DMP1-like (B). Post-translational modifications are not required for DMP1’s specificity for V3 (C). The attach- ment assays were carried out and evaluated as described above. The bars show the mean S.E. of three experiments each performed in triplicate.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Expressing, Construct, Sequencing, Modification, Activity Assay

FIGURE 8. V3 integrin is required for haptotactic migration by cells onto any of the three SIBLINGs. Migration permissivity of wt-HSG, V3- HSG (A) or MG63 cells (B) were tested in Transwells for which the bottom of the membranes were coated with the noted SIBLINGs or left uncoated (con- trol) before cells were added to the upper chambers. Cell migration was eval- uated by counting the 4,6-diamidino-2-phenylindole-stained cells on the lower, SIBLINGs-coated surface in random 40 fields after 24 h (HSG) or 5 h (MG63). Native HSG cells (lacking V3) did not migrate onto any SIBLINGs until this integrin was expressed (HSG-V3, A). Note that DMP1 always sup- ported significantly lower levels of migration than BSP or OPN. The bars show the mean from 10 40 fields S.E. of a representative experiment. **, p 0.001 compared with cell migrated on BSP or OPN by using the t test.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE 8. V3 integrin is required for haptotactic migration by cells onto any of the three SIBLINGs. Migration permissivity of wt-HSG, V3- HSG (A) or MG63 cells (B) were tested in Transwells for which the bottom of the membranes were coated with the noted SIBLINGs or left uncoated (con- trol) before cells were added to the upper chambers. Cell migration was eval- uated by counting the 4,6-diamidino-2-phenylindole-stained cells on the lower, SIBLINGs-coated surface in random 40 fields after 24 h (HSG) or 5 h (MG63). Native HSG cells (lacking V3) did not migrate onto any SIBLINGs until this integrin was expressed (HSG-V3, A). Note that DMP1 always sup- ported significantly lower levels of migration than BSP or OPN. The bars show the mean from 10 40 fields S.E. of a representative experiment. **, p 0.001 compared with cell migrated on BSP or OPN by using the t test.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Migration, Staining

FIGURE 9. Changing of the Met215-Gln216 to the chemically similar IIe-His in DMP1’s BMP1-cleavage site completely abolished processing in vitro and in vivo. A, in vitro processing. Recombinant DMP1Mix (containing full- length as well as the BMP1-like cleavage fragments from original production ofproteininhumanbonemarrowstromalcells,lane2)isfullyprocessedupon addition of rBMP1 (lane 3) DMP1MQIH (full-length protein with a MQ-to-IH mutation in BMP1-cleavage site, lane 4) was not digested by rBMP1 (lane 5). B, in vivo processing. HSG cells infected with adenoviruses expressing DMP1 (left lanes) shows a small amount of endogenous BMP1-like cleavage activity (first lane) and complete digestion with even lowest dose of BMP1 adenovirus (lane 2). DMP1MQIH mutant co-infected without (first of the right lanes) and even the highest dose of BMP1 adenovirus (last lane) showed no processing of the cleavage-site mutant protein. 48 h post-infection conditioned media were electrophoresed with SDS on a 4–12% NuPAGE before detection with StainsAll.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE 9. Changing of the Met215-Gln216 to the chemically similar IIe-His in DMP1’s BMP1-cleavage site completely abolished processing in vitro and in vivo. A, in vitro processing. Recombinant DMP1Mix (containing full- length as well as the BMP1-like cleavage fragments from original production ofproteininhumanbonemarrowstromalcells,lane2)isfullyprocessedupon addition of rBMP1 (lane 3) DMP1MQIH (full-length protein with a MQ-to-IH mutation in BMP1-cleavage site, lane 4) was not digested by rBMP1 (lane 5). B, in vivo processing. HSG cells infected with adenoviruses expressing DMP1 (left lanes) shows a small amount of endogenous BMP1-like cleavage activity (first lane) and complete digestion with even lowest dose of BMP1 adenovirus (lane 2). DMP1MQIH mutant co-infected without (first of the right lanes) and even the highest dose of BMP1 adenovirus (last lane) showed no processing of the cleavage-site mutant protein. 48 h post-infection conditioned media were electrophoresed with SDS on a 4–12% NuPAGE before detection with StainsAll.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: In Vitro, In Vivo, Recombinant, Mutagenesis, Infection, Expressing, Activity Assay

FIGURE10.ProteoglycanformofDMP1hasanimpairedabilitytosupport cell adhesion and migration in comparison to full-length and BMP1-pro- cessed DMP1 fragments. V3-expressing HSG and MG63 cells were tested for their ability to attach (A) and haptotactically migrate (B) onto different DMP1 isoforms: DMP1MQIH (full-length protein only due to a mutation in BMP1-cleavage site); DMP1Mix (full-length plus BMP1-like cleavage frag- ments); DMP1Frags (fully digested by recombinant BMP1); DMP1MQIH-PG (proteoglycan form of full length DMP1); DMP1MQIH-PG/chondroitinase ABC (proteoglycan form of DMP1MQIH-PG after in situ treatment with chondroiti- nase ABC (cABC)). The attachment and migration assays were performed and evaluated as described above. Notice that the proteoglycans form signifi- cantly inhibited both the attachment (A) and haptotactic migration (B) of both V3-expressing cells and that attachment activity was recovered by theremovaloftheGAGchaininsitubychondroitinaseABC.Thebarsshowthe mean S.E. of three experiments each performed in triplicate. **, p 0.001; *, p 0.01, as obtained for multiple comparisons by using of analysis of variance and the Newman-Keuls test.

Journal: Journal of Biological Chemistry

Article Title: Dentin Matrix Protein-1 Isoforms Promote Differential Cell Attachment and Migration

doi: 10.1074/jbc.m804283200

Figure Lengend Snippet: FIGURE10.ProteoglycanformofDMP1hasanimpairedabilitytosupport cell adhesion and migration in comparison to full-length and BMP1-pro- cessed DMP1 fragments. V3-expressing HSG and MG63 cells were tested for their ability to attach (A) and haptotactically migrate (B) onto different DMP1 isoforms: DMP1MQIH (full-length protein only due to a mutation in BMP1-cleavage site); DMP1Mix (full-length plus BMP1-like cleavage frag- ments); DMP1Frags (fully digested by recombinant BMP1); DMP1MQIH-PG (proteoglycan form of full length DMP1); DMP1MQIH-PG/chondroitinase ABC (proteoglycan form of DMP1MQIH-PG after in situ treatment with chondroiti- nase ABC (cABC)). The attachment and migration assays were performed and evaluated as described above. Notice that the proteoglycans form signifi- cantly inhibited both the attachment (A) and haptotactic migration (B) of both V3-expressing cells and that attachment activity was recovered by theremovaloftheGAGchaininsitubychondroitinaseABC.Thebarsshowthe mean S.E. of three experiments each performed in triplicate. **, p 0.001; *, p 0.01, as obtained for multiple comparisons by using of analysis of variance and the Newman-Keuls test.

Article Snippet: In Vitro BMP1 Enzyme Digestion—10 g of recombinant human DMP1 and DMP1MQ IH mutant protein were separately incubated with 0.5 g of recombinant BMP1 (R&D Systems) in a 50- l total volume of reaction buffer (25mMHEPES, 0.01% Brij, pH 7.5) or reaction buffer alone for 19 h at 37 °C.

Techniques: Migration, Comparison, Expressing, Mutagenesis, Recombinant, In Situ, Activity Assay

( A ) A schematic diagram showing that PR-flox is crossed to Mx1-Cre. Mx1-Cre can be activated by IFNα to delete exon 2 of the PR gene to generate PR mutants (ΔPR). ( B ) Mx1-Cre;PR-flox/flox calvarial cells were treated with IFNα (500 units/mL) or without IFNα (control) for three days. The cells were then differentiated into osteoblasts in osteogenic medium without IFNα for 14 days. The relative expressions of RUNX2, Osteocalcin (Ocn) and DMP1 were evaluated by real-time PCR at day 14 and normalized to endogenous β-actin. ( C ) The cells were collected for alkaline phosphatase (ALP) activity assays on day 10 and alizarin red staining (AR) on day 21. The optical density (OD) values were normalized to the corresponding total protein concentrations. Calvarial cells from the PR-flox/flox (without Cre) mice were used as a negative control to exclude the effect of INFα itself. ( D ) The calvariae obtained from Mx1-Cre;mT/mG double transgenic pups exhibited significant numbers (~40%) of cells that became GFP-positive after three days of IFNα (500 units/mL) treatment, and significantly more cells (~80%) became GFP-positive after an additional six days of culture without IFNα. ( E ) Genomic DNA was isolated from PR-flox/flox calvarial cells three days after IFNα treatment, and subjected to PR allele-specific PCR. The deleted PR band (ΔPR) indicated Cre-mediated DNA recombination. ( F ) Five-weeks-old PR-flox/flox or Mx1-Cre;PR-flox/flox mice were injected with pI-pC. Calvariae were collected five months later for microCT analysis for bone volume and (G) representative calvarial images from microCT scans.

Journal: PLoS ONE

Article Title: Inactivation of the Progesterone Receptor in Mx1+ Cells Potentiates Osteogenesis in Calvaria but Not in Long Bone

doi: 10.1371/journal.pone.0139490

Figure Lengend Snippet: ( A ) A schematic diagram showing that PR-flox is crossed to Mx1-Cre. Mx1-Cre can be activated by IFNα to delete exon 2 of the PR gene to generate PR mutants (ΔPR). ( B ) Mx1-Cre;PR-flox/flox calvarial cells were treated with IFNα (500 units/mL) or without IFNα (control) for three days. The cells were then differentiated into osteoblasts in osteogenic medium without IFNα for 14 days. The relative expressions of RUNX2, Osteocalcin (Ocn) and DMP1 were evaluated by real-time PCR at day 14 and normalized to endogenous β-actin. ( C ) The cells were collected for alkaline phosphatase (ALP) activity assays on day 10 and alizarin red staining (AR) on day 21. The optical density (OD) values were normalized to the corresponding total protein concentrations. Calvarial cells from the PR-flox/flox (without Cre) mice were used as a negative control to exclude the effect of INFα itself. ( D ) The calvariae obtained from Mx1-Cre;mT/mG double transgenic pups exhibited significant numbers (~40%) of cells that became GFP-positive after three days of IFNα (500 units/mL) treatment, and significantly more cells (~80%) became GFP-positive after an additional six days of culture without IFNα. ( E ) Genomic DNA was isolated from PR-flox/flox calvarial cells three days after IFNα treatment, and subjected to PR allele-specific PCR. The deleted PR band (ΔPR) indicated Cre-mediated DNA recombination. ( F ) Five-weeks-old PR-flox/flox or Mx1-Cre;PR-flox/flox mice were injected with pI-pC. Calvariae were collected five months later for microCT analysis for bone volume and (G) representative calvarial images from microCT scans.

Article Snippet: The primers used were as follows: RUNX2 ( TGGCTTGGGTTTCAGGTTAG , CCTCCCTTCTCAACCTCTAATG ); Osteocalcin ( TGTGACGAGCTATCAAACCAG , GAGGATCAAGTTCTGGAGAGC ); and the DMP1 primers (HP226170) were ordered from the ORIGENE company.

Techniques: Real-time Polymerase Chain Reaction, Activity Assay, Staining, Negative Control, Transgenic Assay, Isolation, Injection